Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:83-e6   

Cenix:83-e6RNAiCenix:83-e6
PCR_productcenix:83-e6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C47E12.10 Source_evidenceePCR891WS150 Sequence/Annotation Release
C47E12.12 Source_evidenceePCR79WS150 Sequence/Annotation Release
Overlaps_Gene C47E12.10 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score Abs_score786
Max_abs_score786C47E12.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV99724239974113
C47E12.12 Source_evidenceePCR79WS150 Sequence/Annotation Release
Overlaps_transcript C47E12.12 Source_evidenceePCR79WS150 Sequence/Annotation Release
C47E12.10 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textTH:83-e61691ttccatgtccttttcccttgtgatgtctcgatttatgttttttcgtctgttttcttttgcaacatgttgttggaacataaagtagcacaaacaatggagcagtgaagaagagatggtaaacaatcagatttgttacgaaatactctgaacatttgaatttactccttgaattaatgcaacaaaaatatcactgacccaacataatcgagagtctgactgtagagttttgcgaaatagaagaaatacatttttttgaattcgtttatgatttaatcttctaaattaaataaaagtaatccacgtaacaggtcattccaatgacgaaataaaaattcacccaaaatcttttatttttagcatttcatttaaactttatgggaattgaaaccatatcgaaatggtgactttatcggtaatactcacgaagtcacttcttttggttggaatcttgtttgaggttagttatcttgagtgacaaaaagaaatgggtttatttcatattttatatcttcagccaccttacatttacataattatcattcaactttccactttccttttcattcaatgtggaagtaaaaagaaaaaagaaaaaagcgaatcagaagacgaaacagaagatgaagactcagaaaatcaacgtcgtcgaaagaaacgggcggccgataaaaagagaaaaaagataaaggcggcaaaggtagcagctcagaaaaaagaagttgttttcatttaaaaatatttcctattaactttgtttgaatttaaaggggcctgttgttccaaaaccaccaaaaaatcgtgccgcaattgctgaaacgtatgacccaaattatcaaacattagctgggcttaacaatgacctagtgtttggagagcaacccggagcaggtaaaacatttaaaataatacccagagtttaaaatagatttaggtcctcgagccccgccgcctggatccaatcctggaatggttggaaccgcagatcctaattaccaaacattggcagggctcaacaatgatttagtttttggagggggaggcggaggtcccgcaccaccgaaggctccaactgttggaggaaaagctgcaactaatgaccccaactatcaggtttctattgaatccgtcagtttgattcatagctgggtgttttcagacactcgcggatcttcacaacgaagaaatctttaaagaaaaaggggcgaaacctcctgagaatgtcgcgaaggctgctacgaacgatcccaactatcaggtagatactatgataaagtgaattttcttatttgagatcttatattttcagaccttagccggactccgcaatgatgagattttcaagccaaaaaacccagctgctcctgttcaacctccagctcgcgatgtacaaactccatttataaataacaatgatctccgtccaaaacaaccagttcaaaaaaatgtaaaagcaggaatgtatgatcctaactatcagacactcgccggtctcaatcaggatatttttggagctgacaagaagaagaattactagctcaatcagtcacttgtgaataaatatttggaaacttaaatattgttcaactaaacattttaatggctacaggaaaattgcatttgtaaaggaaattataaaatgtttttggaaaattttgattgtaaaggtaaaatccaaacatgggtacgcattt