Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:84-a1   

Cenix:84-a1RNAiCenix:84-a1
PCR_productcenix:84-a1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10C2.3 Source_evidenceePCR1257WS150 Sequence/Annotation Release
Overlaps_Gene F10C2.3 Source_evidenceePCR1257WS150 Sequence/Annotation Release
Chunk_score Abs_score1131
Max_abs_score1131F10C2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1202404312025729
Overlaps_transcriptF10C2.3 Source_evidenceePCR1257WS150 Sequence/Annotation Release
WB_DNA_textTH:84-a11687cctgggaccaatcgattctagagtatgttctcgacgacggctctagacccacccaacttgcttgtcatgatgccaaagtgcagcctgagcttacttttttggatgaaaatgtgagtgtcagtgagagagagtgtgtgtcaaatgcagagagaatataaatatcaatcttttcgagtctagggagttcttcaactcaactctactgctgtcagcgaaagttctttaaaagttgaatgtcaatatcgtacctacgacaaaatggatggagacgatgaacaacttaattattctgaatggatatctttcaacgtaagtttttttctgtagaatcgtaccccgttttgtagaaaaatccgatgttttccttttcttcgtacagtaggagatcgtaatccattcttaattggatttacatggcctatggttgtcaataaaacaaaaatcgtacagtttttcgtaatgtgcttttttcaactacagtcaccataattcaataatatatctcgacctcaataaaatatgtcaagtcgtgttttcagatgtctgtcaaaattgaatcggaattcgttgaagtgtcatgccaacgagcatggtttcctcgtacaaaagtgtattctaataatcataatcagataataccaatttctcgatctcaaccagtatccgataaatcatcggttattgtgattgttctcgactcggtctcacactccaatttccggcggacaatgaataaaacactagatgtgatgcattctctttatggatcatttatatttgatggaatgacaaaaattggcgataattctttttcgaatgctgttggcttttttgccggaaaatggtggaataccgagttcggagatgcccatggatattttgatgatcatgatttgatatggaaacattatcgagaaaacggttatcgtacactgtacgcagaggattatccaggatttaatttgttcaattatttatcaaaaggattcaaaaagaaaccagtggatcattattttaggccatattggttgaacgtctattggacatatgttcatcgaagaagtagaaatctatgttatggaaaccatagaatgcataatttacaactaaactatttatcacaatttgtatcaaagtacaaaggtaatccaaaataataaatcaatttcactagatacttcagaccaaccaaaatttgcgatctcttggcttactgaacttggacacgactggttgaatcaagttcgttatggagatgaagatctcgcgaatttcttgaagaagcacgttgaggatctcgagaattcttacctttttattatgtcggatcacggtcatagatttgataatattagaaaaacgagcatcggaaggttagaagaacgacttccatttttttcggtttcattaccgaaaaagttgaggaaagattcaaagttggtggatactgttagaaagaactcaaaggtatggtaatcgatttagggaaaattagattatttgagataattccagaaactgacatcattttttgatgtttatgcaacttttcggcatattcttaacaattcaaaacagccagatgttatgaggggtgaaagtctgtttcttcccataaaggttagagttgaaatctttttttgatttaaaacttagttttaggaccgaaattgtgaaaccgcacaca