Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:88-d4   

Cenix:88-d4RNAiCenix:88-d4
PCR_productcenix:88-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR53.6 Source_evidenceePCR601WS150 Sequence/Annotation Release
Overlaps_Gene R53.6 Source_evidenceePCR609WS150 Sequence/Annotation Release
Chunk_score Abs_score483
Max_abs_score483R53.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII99683749969484
Overlaps_transcriptR53.6 Source_evidenceePCR609WS150 Sequence/Annotation Release
WB_DNA_textTH:88-d41111atgtgtgcagttttcaacgggcggcgatacatttcggctaatcgctgcgagacccatggccgtggccgagtctacaactagttcacaagagccgaaatggtgggaaagtcgaggactttaaatttaatgttttttattttcgaatttaatatttaaaatcaagtatttccctttaaaattttatttttcaaatcaacttttaatttttgcagttcaaaaaatgagttccggcgatcagaatcgaggaggcgtcgccgacaaagcactacaacttgttttagagatgaaaagaaatccagatgtattaccgccttataacgtaaaattatatcctattttctgctttaaatttgagttcttttcagacagaacttgtacgccaatgttatcagaaaatcgatgagttgtttcaaaagaatgctgccgtcgtgtaagtgatacatttcggaagcgtaccgattcgttcgtgacttcttgatttaaaatcatatttttcagtgaaaaaatccgtgcaggactccctcatgattctacgcttcttcaacctcgtttagctgcaatgtgccatattcgagtaagtcgagaaggtcgatttttgaaatattgtagtggttcaattttccagcgttgcatgatggcctatgtgaacgagaggaaaaacaggattcgatcattcagatggaagtatggaggtgctcttcccgcgtctgttagggtaatcggtgcacatgattaaaatttgtcaaccattatttttcagaacgccctctgcgatgcggaaattcagtttttcaatgagtattcgagcacattggcaagattccaaagcaatcttggagaaggtggtgttaatctgctgcttcattctgcaccaccgaagtcactttttgtacaagttagagctctcgaggattatggagaatttgaaacgtcagatggaactcaagttcagctgtccaaggatagtttggtaagtcttcgaatttttctttatttgaaaaaagagaaatcccgtttttaattttttaaataatgtataacatttttcagcactcccttccacgccaagactgcgaaatgctgatacgtcagggtgttctcgagcttgttc