Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:88-e12   

Cenix:88-e12RNAiCenix:88-e12
PCR_productcenix:88-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10H4.12 Source_evidenceePCR576WS150 Sequence/Annotation Release
Overlaps_Gene T10H4.12 Source_evidenceePCR636WS150 Sequence/Annotation Release
Chunk_score Abs_score596
Max_abs_score596T10H4.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1530058115301636
Overlaps_transcriptT10H4.12 Source_evidenceePCR636WS150 Sequence/Annotation Release
WB_DNA_textTH:88-e121056aggcatacatccgtgtcctccgtaatctccacctgttactgctccactactggcccagaaacgcaacgcctcaattgagtagcctcccttacatccgtaaccacaggttgttccacaacaagaaagaatatcttcaactgagatcacaggttgttgagttccattagactgaatgcacactcggtcggaaatcacctctgccgcaccgaaagcccagcaggatccgcaggtggcctggtttcggataagctttattgtattacagtctggccatttttctctggcgtcaaaagtgtcggggagtggttctggaacaatctctcctctaacgaaaagctcactggccacatcggaatctttttccaaaggctctgcgaacttcacatccatcactttgaacttcatctcaaactcggaaatctcattgtgctctgccacccagctggtttgtacggtgttcacatgatctacaaggactttctgaggtgactgcccaatattgattccgcggatttcatcaagaacaaatgcagagcacccggctagaaacagtgcctaaatgtaagaaaaataatggaaaaaatgaagatgaagatgactcaccaaaaagtacactttcagcattctctttagtattcaatttttgaaatttgagggaaaactgaaaactggaaagaagcgtttcagcaaacacacaccgcacattttgtagctttcccttatcactaaaatttcgacattttcccctcttatgtttgtctattcaaaaaaaaagttagtcatcagtcgagaacacggaggttagtgtcaccgaatcaagaaatcaattatcaccttcgttgatatcatcattatgaattaggagggagcttatcaggcttatcaaagcgttgaggtgtgtgtaatgtaggcatttggtcacactttagggtaaattgtctggaattttattatagagatttatgcaattgtactcaaagtttttaaagttttacaaacttttttcaatctgttttccaactttttaattttctctgcaaaacagtggtgaatcga