Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:89-c1   

Cenix:89-c1RNAiCenix:89-c1
PCR_productcenix:89-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T21B10.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
T21B10.2c Source_evidenceePCR92WS150 Sequence/Annotation Release
Overlaps_Gene T21B10.1 Source_evidenceePCR998WS150 Sequence/Annotation Release
Chunk_score Abs_score935
Max_abs_score935T21B10.1
Specificity_index0.912
Rel_score1
Map_statusBest_ePCRII89297528931253
T21B10.2 Source_evidenceePCR110WS150 Sequence/Annotation Release
Chunk_score Abs_score90
Specificity_index0.088
Rel_score0.096
Map_statusBottom50_percentile_ePCRII89297528931253
Overlaps_transcript T21B10.1 Source_evidenceePCR998WS150 Sequence/Annotation Release
T21B10.2c Source_evidenceePCR110WS150 Sequence/Annotation Release
WB_DNA_textTH:89-c11502gaactgccaaaagatgcacaggagttttccgaggcttgtccgatcgcaaggtaacttgttgaaaggaatgtttggaaaatccggggaaaaggaagcagtaaagcagctgacactggaagaacaggagagccttcgcaagacgcttcccagcatccgtgctagagaatccacacaagttactgcttcagctgattctgtcactgaatttgacgatgatctgttgacgatgagccgtatcgacacggatgccatccgggccagaggttttctcaaatacacgcaaaactatgttcccggcgttgatgtcaaaaaccaagtacttgaagcagcgtcatcatgtctaagaagtgctggagtaaagtctgaaaacgtggatcagtacaaatttgtggaaggagataactctgtaaagttcgagttgttgaacaggctgggaaaatccatcgaacattggccaaccaatggaaaacttcttcatttggaaacagtggcagacgtcgtcgaattttatcagacgcctgtcaaaaatgtaacaaaatatacagagttagtttttgtttaaagatgcttattgaattattaattaaaataaattatagaatggctcgcgatgagaacaaaccgaaaaacgtctcgattatggagcatgctgcacgtttccatcctgaagacactcacatgtatcatggtggaatcactgcattcccaggatcaggtggtgaagttctctctctgagacagaaacgtctacttcgacagttccaaccgaaaaaagaatggttcgattatgatgatcaggtaatttttaaagtttcagtgctgacttaaaatcggcatttttcagacatttgattacactcgtcctgacaagaatatgccatgggatccagaagttgctaatcaaatggacaaatacactgataaacgatacaacctaaaaacaaagcaattcactaggattcgacaataaaaaataatttggttcatttttgtattagagtttcatatttagtatttttagacctattttctttttgtttgatctatcgatttttattgttgtaaataaaattgacgttgaaaaaaatatttttgacctcttcacgttttgatcttcctctaaagttttgctctacgcaagttatttcagtttttgatttaaaatgtttgttccattcacctcggcagctcactcgctcacttcgctcattcgaggtggcgggcagccttcgaaaagcaatctgtctggacaaaggttttggttatctctttttctttattttccgccagttgatttcatgctcccgcgacttccacacgcaatctgcaaaattttggctgctgaatcagggtaatggggtctgccgtgccttttttccaaaacgttgactgatgtttacttttcttttatgtttcattttgacttgttcaatggttttgaacaatagtgtgtgcaaactaacgtttttctttaaattcaacacgcaagctttgaggtgttt