Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:89-f12   

Cenix:89-f12RNAiCenix:89-f12
PCR_productcenix:89-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04D2.4 Source_evidenceePCR548WS150 Sequence/Annotation Release
Overlaps_Gene W04D2.4 Source_evidenceePCR548WS150 Sequence/Annotation Release
Chunk_score Abs_score485
Max_abs_score485W04D2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1249968412500489
Overlaps_transcriptW04D2.4 Source_evidenceePCR548WS150 Sequence/Annotation Release
WB_DNA_textTH:89-f12806gcctctcaaagcatacccatcattatgttctgttgcatgaataaaagcagtacacgtgaatcctaatcgaaatggtcctgtacgatcattggctgtattcttatcactactcacattgccacttcgattgcatgccaaaaaaattccttttccacgcccacgtcgttttgatcccgatttgtgtcgaaaatgagcaccaccttccgactctaaccagaatctgaaccgctgaaaaattaataattatcaaatgtcaaattttagatctcctacttcaaatgtagcacggtccgggaattccattgaatgaacatccggaagaacgtcgtgctcaatacgcaaatgactgtggaactcaggtctcgtgataaattcggaactacacaatccgcaacaataaaatctctttttgagttgaggatgcgaaaccatattatcgctttgattacgtccacatccattattcttgtgataatcgatcgttcgagaggcaatcaatttgttgcatccataggggcatatataacgtggttgttgaggctaaaatagttcatattaatttgctaaacacattgctgaaaacagacatacttttaattccatgtaagcttccacatgcatgtcatcttcaagatgatgatcatcgatatcatcagtcattctgaaattataaatatcaacaatacataactaaatatttcaaaaaatgaaatataattaggacgttttatagagaaaaataagaacatgaaagcacagcgttaatcattttttatttgaatgaaaaacagtcgaaggacaatcgg