Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:89-h4   

Cenix:89-h4RNAiCenix:89-h4
PCR_productcenix:89-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW04A4.5 Source_evidenceePCR686WS150 Sequence/Annotation Release
Overlaps_Gene W04A4.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647W04A4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1366327813664322
Overlaps_transcriptW04A4.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textTH:89-h41045gggcaagtgagaggtgagagacgacgagagcgacttgcttgcgcatttcacgcgcacgaggccgtgataaatatttgaaataaagaagttccctccgtaaatcgtgttgactgagtattcaacgttttgcacgcgttcaggtacgcagcgaattgagtccagcggagcgcacttgccttttttacatttttaatgaaaatattttcgaaaaatacattgcggaaccgaattttccagtgaaaaatgctcaccagagctcctcggaaacgtgaattgctcggcgagccacaactaagccagcctccatcgaaaaagaatcgtttggataaacaagcggagcgaagttttcgaagaaggaatctacaggaggttctcgatgagctgtgccttcgagtggagagtaacgatagacaattgtaatgaaaattgatttgaagaagcttaattaattaaattaaatttttagaacaaataatctcatccgggagatcgacacggagcatgtacgggttatcagagataaggactttgcgaaaagctgcacaaagctcatcaaagcttgtttgacctcaaaagtaacattaaaaactacttaaaatctcctaaaactataaaaaacgattaaaaatcttaatttcagatcgaaacagtctcaaataagatgtttgcctgtttaatgggaatgttcgcacgtggatctttacaaagaagaaaggatttcgtgttttccctccaagaagtctgtgaaggattatcccaagcaatcaaagagcctgcaaagatccttccggatcccagaagaatcgtagaaacatcgaatttcgactcgggcgcggaatccgacaccgattcagaagcttccaataaaaaaccggcggattttaagccaagaatcgaagatattctgccgatggatgaggaggaagacgagatttcaatgattgatgcgttgtatttgaagccaaatttggattctggagtgctcacgatttatacgatggttctccgagagaagattattcaggctgacgaagttccggagaag