Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:89-h8   

Cenix:89-h8RNAiCenix:89-h8
PCR_productcenix:89-h8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW03B1.4 Source_evidenceePCR798WS150 Sequence/Annotation Release
Overlaps_Gene W03B1.4 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792W03B1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV43586864360294
Overlaps_transcriptW03B1.4 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textTH:89-h81609ctggcaagtctggaaaaagcccttctggattatgctcacgaaagagtatgtgctctaggctttcgtccaattacagtacccgatatagtgtctggagaggtgacacaagcctgtggagttatgcaacgaagtgatcatccaattcaatacaccttagctggagaagaatcacacacaaaactctcaggaactgctgaaatgggaatcgccgcgtttttacggggacgaactttcaaccaagatcaacttccgattcgattggtctcactgagtcgatgcttccgaactgagatcagcaagtcggcgagcgaggcgaagttgtacagagttcatgagttcagcaaggttgagatgttcgtggtgagcacgccggagcaaagtgcggcagagctggattatttggtggaggtgcagaagggaacattccaggcgttgggtgttcattgcaggtgaatattacgataatcaagtgttagaaagaccgaatttcgatatgaaacgtcccaaaaaatagcgaaaaaaatagaaaaatgttgctaaaatctgaattttcgccatcatttctttgtcgaagcacctggaatgcagtttttttttggaattatcacattttatcgcctaatttaatagttttcctcgctttaattcgttgatttaggcagattttaagccaataggcactaaaaaacttcaaattagcgaaatttctgactttttggcccctttttttgaaaattttttgaggaatcccatgaagaaactcattttttccccatttccagacaacttgaaatgccatccgaagagcttggagcctctgccgcccggaaattcgacattgaagcttggatgccggggcgaaaactctacggagaggtttcatcggccagtaattgcacggatttccagtctcgacgcctcggaatcaagtataaaactgctgatggaacgacgaaatacgctcatacgtgtaatggaaccgctcttgcgtcgactagagctctcatttctgtgctggaaacttttcagaatgtaatttattgaatttaaagtgtcttaaaactctaaatttgttgtttttcaggacaaaaaaggactcggcgagcttccagaacctcttcgaaaacgtgtcaagcaacgtggaagcccacttcgtttccaaccagcgaaatcacttgtttagcgtaatttaaatttacatttacgtgttttttttaatgaaaaaataaatagtttagataaatattgattttttaattcatttcctagcttcttttatttcaaaatgaatcgatttggttttctgttccttcttcacgcaggactcagcgaagcaggtggaggaggatccagtgactttttgcagtgagaaatctgaatttttggaggagaaaaagctgaataacttccagatcaacagttttccttatcggtatcgccgttttcactgcaatcgtcggaggtttgctcgtctatgcttgcctaatcgacataaaacattggagaaaaagcattgacggaagagctcagctggaatttcccagtgcttcgccggcagaattcgtgcttccgccgattcagcgaacaccggagaatctggtgactccga