Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:90-b4   

Cenix:90-b4RNAiCenix:90-b4
PCR_productcenix:90-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY110A7A.13 Source_evidenceePCR867WS150 Sequence/Annotation Release
Overlaps_Gene Y110A7A.13 Source_evidenceePCR940WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI51037375104771
Overlaps_transcriptY110A7A.13 Source_evidenceePCR940WS150 Sequence/Annotation Release
WB_DNA_textTH:90-b41035agatcaatgtgggattgggaaacggtttgggaacaaatagaaagatatgtttgatggaaattaaaatcaaagtttaagcttcttcatcattttttgcatccagttcaggatcaaatttgagacgaggccatccggttccgtgtttttgtttcaatgaaatttcgacctttctttcgccaatgacaacacgactttcctcgggaataacttcatcccataaatcgtaatcgagatccacgcttgcatttccaaatccgtgcttcatactcactcgaacggtgtgaccatcggaaacgatgtttgcggtttcgggtagagcacctctacaatacacgttgatggtgacaaatccattgctcgaaaaccaatcttctcggaatttgctgacaatttcattctgaaaaacgccgatttttttttgaagttttgaagttttttcaactcacatttctgaacttatgttcgcctgaagtgcagcccacttgctcaaggaaagctccaaaattagaagttttcttgttacaacacgaccaatacttcattccttcgtggaaaatggcagctccagggtgatgctgacagttttccttgtttttcgatccatcgaattcagtagaacatccattgtttcgacatggggcgccaatttgaatatccgcactttgagcagcttcagatatttctttcagctttttctcaatagctgcggttgctccaggcgtcacttcaacctgcaatacgtgtttgttataaaaaatttaatttaaaaatacaaacattcaaattttgctcaattctctttgtcgcatccttgctatccaattttccagatttattgagccctttccaaacaataacatcttcttctttctctggtcgaatttcctttaccgcggcaacttttacaatatcgactggtttttcattgctgtgttttccacgcgtacatcctttataattcatccatgtaccgaaatcagtacttttcttatcacaacatgtccaaatcttgtatgcatcatggaaatacggacc