Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:90-c7   

Cenix:90-c7RNAiCenix:90-c7
PCR_productcenix:90-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY49A3A.3 Source_evidenceePCR1147WS150 Sequence/Annotation Release
Overlaps_Gene Y49A3A.2 Source_evidenceePCR3WS150 Sequence/Annotation Release
Y49A3A.3 Source_evidenceePCR1178WS150 Sequence/Annotation Release
Chunk_score Abs_score1115
Max_abs_score1115Y49A3A.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1435700814358273
Overlaps_transcript Y49A3A.2.2 Source_evidenceePCR3WS150 Sequence/Annotation Release
Y49A3A.2.1 Source_evidenceePCR3WS150 Sequence/Annotation Release
Y49A3A.3 Source_evidenceePCR1178WS150 Sequence/Annotation Release
WB_DNA_textTH:90-c71266aaatatctcgcacgcaggtctcgttttcaaaatggaattggattcggtgaagcagcaacaacagcagaacgcttgctgtgaatatattctaccaattaagaagcgacggtgtaagatgctggtgaaaaagggaaatcggttctgtggagagcattcaattcacgatcagaataacactgatcgtatggtttgcccgaatgatggaaaacatacgattctgaaggcagatctagagattcatctgacaaggtgtaattctagaatcagagatgcagaatatatcaaaattgatgcaaattctattcgtggcgagaccaaacgcaccgataaaattgatcgaagagccactgaagatgagatttgtaccactgtgcacaagatctggaagtgctatgagacggatgtaatggatcgtttgattgttgagcaacaaagaaatgagctcgtcgagcaaaatatcgcacaaaattcagatctgaacaacacgaaaaagaagcaattataccagatttcgtctattttaggttttataaaatgcatttccattttaataattttcttttcaggtcacatcgaatccacagggctacttccaacttgctccaaatcttgcatgttcgagctcggagctggaaaaggtcaactagcttattggatctccaaagcagcgccaaatggaaattatattctcatggatcgctctggatcacgaaataaatttgatactgctgcatttcgagagaatccgaatttatcaatgaaacgcttccgatgctcaattgaacatatggacttgagcaagattgatgagctgaaggtgagttttacagtttttatccaaaaaaatctttatctttttttagaactctgaaaagattttggcaatctgtaaacatttttgtggaagcgcgacagacgctggaattcgatcgttgatgaatagtggtctacaattcaacgctgcacttctgatcccttgttgccatcacaaatcgcgattcgcagaatatggaggacatgattttttggagaaatgggaaatgaatgatgaagcttcgtttgctgcacttcgatatattgcatcgtttgcaacaaatggagcagttgatacagaagcaactgaaggatggaagtcaattcatccgccattagagcttggacgaagagcgaaagccatccttgaaatcggacgagcaatttggctggaaagtgttggattcaagacgagagttgtagaatacgtgccgccagaagtatcaccggaaa