Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:91-e10   

Cenix:91-e10RNAiCenix:91-e10
PCR_productcenix:91-e10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK973.5 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene ZK973.5 (3)
Overlaps_transcriptZK973.5 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textTH:91-e101328aagccggctcaatctactcaagtaccgccagcgtgagtcatagccaaactttcgggggctcttttattagacatttagtttcttatatgctctttcgactgatattactactattttcaattaggctatgcagttttacagcatataaaagtttattcgaaactttactggctaggttgagttgaagctttaaaacacatatcatatgtacccatttttcaagatacaataaaattgcgttcccatctggtgagttcaacaatacactcacaattgaattcaaacttcggttggaccaaattgtcgacgtgcatgaaaaagatcaagttatcactttgaaggggacacttattcatgtaaggccccagatggagagattcattttcttatcaattttctttgtttatagcactggcttgattatcgactttcttggaatcccgatgagtttggtaacattactcttatgcatttccctggggagatgctatggctccccgatataatactgtataataagtaagtttgagtttccgaaaaaaaatagttgattcaaatctagcgcccacggaagcccgtgggtatcagagaccacacaagtgcatgtttcattcgaaggacgtgttacatggcaacctccagtagtgtatgatgcattttgcaacattgacattgaatggtatccgtatgacttacaaatttgtgaactcaagttcggctcatggacctacggaggatcacaactcaatttaatacatgtgagattaaaatcaaacttatttcagtaatttttagtattaaagcttactactgatcaagctaatgaaagtactgatgcaaccggcgataatgtatggaaagtagagagaggagttgatttgagcaattatcaggtaagaactacatatctacttataacaaaaaagaacgaactataggagtctgttgaatgggatttgctatcagtagaagggattcgtcacaaaaagtggtacccatgctgtgactatccgtgagttaaagaacatataatcaatttatacagtaatagcttttataaaaatactacttttataatagctttataattcaacaagaatttaatcactaatttatctgtatctactaaaatataaattcctatatatctttcctctccaaattaatacttttcagatcaattgatatcacgtattaccttcatattcgtcggaaaaaattattctacacagtcaacatgataattccatgcgtctgtcttgcatcgatgactctttgggtaacatctaaatttttatctaaatttgtatttggacgtgggctaattg