Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:92-b4   

Cenix:92-b4RNAiCenix:92-b4
PCR_productcenix:92-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y77E11A.7a Source_evidenceePCR534WS150 Sequence/Annotation Release
Y77E11A.7b Source_evidenceePCR528WS150 Sequence/Annotation Release
Y77E11A.7c Source_evidenceePCR450WS150 Sequence/Annotation Release
Overlaps_Gene Y77E11A.7 Source_evidenceePCR534WS150 Sequence/Annotation Release
Chunk_score Abs_score429
Max_abs_score429Y77E11A.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV14178391419535
Overlaps_transcript Y77E11A.7a Source_evidenceePCR534WS150 Sequence/Annotation Release
Y77E11A.7c Source_evidenceePCR450WS150 Sequence/Annotation Release
Y77E11A.7b Source_evidenceePCR528WS150 Sequence/Annotation Release
WB_DNA_textTH:92-b41697ttgccacgattccacaaataactatcaatataataatcggtattttttagtccgtgacggggttcaacaaggaaattctgaggccctttacgtgtttcatcgattgtcaacgggaattctttctgaacttcatgttcttcgtagcaacggaaataaaggaaatgggcagctttgttgggaattgagagatccgaagatttgagattgagagtttctccggtgaatgaggtggctgcggcgacacgctgcaaaacttttttgagacggtttttgctggttttttagaggatttctgtgcaaaaattggggttttttttctgtgattttagacgctttctgaaggcttttcgcaggtatttgaaagtgagttttcggaattttagggcattattttggctctttttaagcagctttttacagtgaattttctgtgaaatttcggctatttctggtcgatttttgatcgttttcagagcatttgaaactttactttgccatttttagtggattctcgttttaggtgtggtttttgctcattttcacaggatttttcaagtaaaaatcctcatttttcagggtttttttcggtgaaaaaatgccattttccgcgataaatcacctgcattgtggtgacgaggtgttcgtcttcattttgatacggtacctttctagtcggagtcggacgcccttgatatttcattgatgatattgtaacctcatttgcaaccgaaaaatcactgtttaagaccatttgagcgtcgattttctcgcgtttcaaagccatttccatttcaatttccattgtttgagtgtccatgtgatcgtcgagcactgacgcgtctggaaattgagaatttttgagattttaggggtttttcaattaaaatttggcctttttcgggaagttttagcttcaaaaatgacattttttgggaattttctaaatgaaattttaattttttggggaatttttaggttgaaaattggattttttgggttttttcgaagtgaaattcgaatttttagagtttttagcttgaaaattaaaattttcgggattttttgagtgaaaatctgattttttaagagattttagcttgaaaattaacattttcaggtaaaaatccggggtttaaagaattttttggcgaaaaattggtttcttaaatgaaaatcgagttttaagacaaatttcatagaaaactgtaacattttccggtagtagcttctgattttcagccgaaaactgaattttaaagtaaaaacctgagttctaggcagtttctccttgaaaacgcgagcatttaggttaaattttagaattttgaagtgaaaaaattacattttttaggtaaaaaatgaacgttttaatgggaaattgcaaatttagagtcgacaatcgacttttcagcacttttccaatgaaaaaacacattttttgattaaaaactgatttttttaaagcaaaatcgtaaattttggtattttccccctaaaaatcgccaattttgcctgatcattgaggattttcgccaatttttccgcgtaaaaatcgcattttcatgtagaaaatccaatttttaccgatttcagtgttggaaacatcgatttcctcctctaaaatcgggctttggtggtgtttctggtgaacttggagctcgtgctcgcctggggtcatatctcgctcctggtcgact