Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:92-h4   

Cenix:92-h4RNAiCenix:92-h4
PCR_productcenix:92-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSAH10.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
Overlaps_Gene AH10.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598AH10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1415902014160114
Overlaps_transcriptAH10.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
WB_DNA_textTH:92-h41095tttcaaatgccacaggtttgtatttgtaagtttttttaattctaagtttttgtccagacttccatttgaatagtaaatccttttcaaaattcacttctagtaaaaaaacataagtttctacttgaagtttcagtatattcttattatacatcacatctttctaaacaattttattccacttatctccaatacccatctacatctacacatatcacttgcaccttttgtctacatgctcgctgagccatatatgcgcacatatacaaaaatgatgactataaaaagtgatgataaataaagagcgctgggcgggccttaacggcccacatacagtttgcagacaaaaacctggaaccaacacagaattccagtcattcaatctgatttttctcgcatcagaatgttctctttttctagagctgttattatattctttactattttcccattgatctctgcaactggacatcttcggttggaactaacgtcgtccaaaaactttatcttacaactgaagacgaacacaagtttccaagaaatccagcttgctatgggtaatccaagaacactgagcttccacccaaaagaccatcaagaaacgcttgagatctcattttccaataatgttagcgatctgacaacagtggaatatcatatgaatagtaatgaactcaatacttatcaaactattctattctctgacgccgttttattggttcagtcagttttcaagtgtgataccgggttcgttggagataaatgccaagatattattacttctacctctaccacagtgatttccacaactacaacagaaatcaaaacttcaactactaaggtaattatagtaatcaatgatgttccaaaagaagcttcggccctgcaacagtaagtttaatttctcaaagttaataatttctgattaatcaaaaacattttcagatccatctctttaaacgtcattcattgctccgtgctcatcgtgatcatcatagtacttctcattcttatcattatcgtctacatcttcctccgtccacatcatcaaaaacacgtttacattcaaccggaatctccagcccaaaatgagagaaa