Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:92-h7   

Cenix:92-h7RNAiCenix:92-h7
PCR_productcenix:92-h7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10H11.10 Source_evidenceePCR795WS150 Sequence/Annotation Release
Overlaps_Gene C10H11.10 Source_evidenceePCR960WS150 Sequence/Annotation Release
Chunk_score Abs_score897
Max_abs_score897C10H11.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI47597514760879
Overlaps_transcriptC10H11.10 Source_evidenceePCR960WS150 Sequence/Annotation Release
WB_DNA_textTH:92-h71129cttcggcttatccaaatccattttccgcttctttctgacctacaacagtgacgccttcaaaataaaatttaaagtgataatcgtctttatttttgacgagaataaaatatattgcaataaaactatagtacatgtgatcacttgtgaataataatatttgacatggaattataaacttaagacgagcgggatgggtgagtattttacaagttaatcaatataaatttatattatttacagcatgcattcgtcgaaacttccgacatcggattccaaatgcggctgccaatccgaatcctcgaagtcggcggatacgtcgtggtcactttcccggctcacacgatcagtgtcgatttccgggccattcggacattcgctgcagatctcgtcgatgctctttttgatgctctggatgcgctctcgaagttgcctagcgagtccttgttctggcccattctggttggcaagtgcacgctgaatggcattttccacacgatccaatcccagaatggcgctcctcgcatcatcagaaacattggcttgatctaggttgatggtcgaactgcttggttcagatgacatttcctctgacgaatgaacgacatatgtgttgcaaaggggattctgagttgattgttcgggctttccgtggtcttgctcagcgtcttccgagtcgacataggccagctggtagaaatctctgttcaatgatttgcacagaatttcattagtttcctctcgactctaaaaaaataagattttagttcaataaaattatatactcaagaaatttaccttgttcaacgttgtcataattacagcattatcaagtagaatcgatgaagtgttgttgaagactgcagctggcacagcgactgtgttggagtcacaatatctcaatggaaccaagctgtactcgtcgtcacttccgtcctcattgattgcaggattcttcggcgtgctggtgtaaagtggtgtgaacggctgtaaaacaacaaaattagcataaagttgttaaaataaatattctcacccgtggctgacgatcttccggagtgttatccaattcgaatcggactgctttcaacacacgaggagggagtttgaatcctttcgatggatgtggagt