Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:93-f12   

Cenix:93-f12RNAiCenix:93-f12
PCR_productcenix:93-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC51F7.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
Overlaps_Gene C51F7.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
Chunk_score Abs_score557
Max_abs_score557C51F7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1231024612311108
Overlaps_transcriptC51F7.2 Source_evidenceePCR641WS150 Sequence/Annotation Release
WB_DNA_textTH:93-f12863aatgggactcgtcttcatgcgacttaccagtataacgtgttataactgtttgatggcaccaattttcagacacataggttagttccacggtgaaaaatttcgtgcatatactactgaaacctagctaaaaaaaatacttgattttaaacgaccggtagtagatttcataaaatttagtttccaggtaattttttgcccttaacatttatgggtacaatggcttatcatatggcatatgttcaatacgctttaacaactcttgtttctttgaatcggttgacagtattgtttaagtataacattttcgaaccggtaaatcaatctacgacgaattcaaagacacaaatagaatttcagatttggaaaaaaattacatggttatttattctagttgcttattttgttccctttctcaacactcatattatttttcaaaataaattcacaattgactatctcaacgaaagcgactcttacacattgcaaaccccaaatatggtgggcggaaacttttacaaaacaaaaaaaaataaaaataaataaataaataacttgattgaggtttcagccattcatagaaatttacaatgtattaattccatttatgtgcatttgtatggcaatttcaattctttccaatactacaagtgtcatatttttacgaaatctgaatattcaaagaaaaaaagcggaaacaaactttttactcataatgtctataacatgtttagtccaacttattggaacaataatttctattgctttattgaagtgcaactattgttctatgttatcatatcttacaatggttctaccatttgttagtgacggtttatctttggtgcaaccttggctgttgattt