Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:93-g12   

Cenix:93-g12RNAiCenix:93-g12
PCR_productcenix:93-g12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C55B7.9 Source_evidenceePCR834WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708C55B7.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64929096493990
Overlaps_transcript C55B7.9.1 Source_evidenceePCR834WS150 Sequence/Annotation Release
C55B7.9.2 Source_evidenceePCR693WS150 Sequence/Annotation Release
WB_DNA_textTH:93-g121082gctgggaacattttcttccagtaatcgactttttccatattaacaagtggcatcagctgatcggcaaaatcacgaagagacttggcagcctaaaatgagttgaaaaaataaattcgaaattattactaaaaaacctaccggcatgtattctgcagactcgggcaatgagatactgatttccactaacgcagaatcagaaacagatttgattgaatttgaatcatatgttcctgcgcgagaagtactagtcaatattgagtgcagaatctttatatttccttttgtccacaattttccttgtgtcatatattcatagtccatgcggagacccaaggatttcgcatacgtcatcatatcctgagaatggacaagtgaactgatttcttttcgaacaatagttgggcatttttgatctggttccggaactgaaataaaacaaaaaattataaaatacgaattataaggttaaaaccgacctccaatgtactttaattgccaataattttgaattcgatgttctgttcggaatcttcttcgcaatcttcaaaaatcaaatacatgcaaatatttaaatagataaacaaaaaagcttacttaatatcggttttgatatccattatacccgaagatcgtaggctgaatgacatctcatgctcgaagaattcctcacatcccggatcacaaaggccggctaaacgtcgttccaagtcctaaagttgaaacttttgtattagaatttagtccaattactttaaaaactaactgggacattttttgcgaaaatagatccataaagaacgcattcttgtgtttgatagggagttgaattcacagaaagctgaattaaaatgttttagatggattttaacaatcgaaataccttttcttgtgttccatcttcatcaatatccactaaattgtccatattttgaatgaatcaactaaataaacagaataaaaaatgtttttaaaaaattaaattaattcaaaactatttgagcgtgatattaaatgtattctacgcaattcacagctggtgtttgcggactcacactctacgtgactcatttccagggaaacca