Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:93-g8   

Cenix:93-g8RNAiCenix:93-g8
PCR_productcenix:93-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47E12.11 Source_evidenceePCR1101WS150 Sequence/Annotation Release
Overlaps_Gene C47E12.11 Source_evidenceePCR1101WS150 Sequence/Annotation Release
Chunk_score Abs_score996
Max_abs_score996C47E12.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV99696869971359
Overlaps_transcriptC47E12.11 Source_evidenceePCR1101WS150 Sequence/Annotation Release
WB_DNA_textTH:93-g81674tgtgggagtgatagctgcaagagcattcagatggtacaaggaagatatcatgttatttaacttttttcgttagtccttcattcatttttaaatcacgtcaataaatagttatactaaaagctgtttgaaacaaattatccgtcatgttttagaaactacatcagtgaacaagaaattaagaaaatgattcggagagctcgttcatggacccgtttggatcgacacataaatggtctcacgatctactacaaacgtcgggaggatgacgtggaagagaaaatggtcagagttactttatttcctgatgcagaaaactctattgattcattgtgctcagtaaaatcacttcccccaagatcagcctcttcgaattctaaacgtcaatcggctggctcgacagcaaaatcgaaaaataaaacaaagtctgaaaaatcgaaaaagacgaaatcccgaggggtgcatgtggcgaaaaagtggcgtaaattcaaaaaaacaaagaaagaatctgaaactcgtttggacgatgacacaattcaaactttggatgatttgaaaacattgaattccactattaggaagcgtttccatattggaaccacttgtcctcatggtttagaaaatttgaaatcgaagagcagagccgaccaactttcgtaagttttgaaattatcatagtttttatgaaattgtgttactttcgattacagatcttcaaaagattctagattttctttcaaaactggtgaaatattggttaagaatttaaatgctcattctgttaaagaatacgattgccgtggaatgtaagacttcgaaagtttttattctgtacaataaagttttacagttctatgatcaatccagttgctcaaactcctttcccaaatgcttgttcagtggaaactagacaaagagcaagagaaaaaatgaaagctttagctaaacgaggaatggtgattgattcaaaccgttgttcgattttcataaaacttacattttaatatttcttaggattctaacgatcttgcctcgtccacatcttcaaaacattcgaccaagaagactaacacaagcgacagctattctgatgatatgtcacctgtctttttgacacgtgtcagttctgatactcgttttcctggtgccacgtctccagctacttgtgaaagagttcgtttaatgctcaaagaatacgcattgagagaacatataaaagactcggattatactggaagccattctaaaaattcgaaaagctcaaagaagaagaatacacaaacggactcaaagagcacaaaatccaagtctttaagtatgaaaactacgtactcagagaggtatcttttttacaaatatcgatgtttttcactgacttttttttcagttcacagcttcgagacagtgattcgtgcagcgaagatgaaagttgggataagcaaaaatcaaaaaaggatgtaaagaaaaagaagggaacaaggggaatgtaaagagagctattgtgattttgaaattatttcttgtctgaatgaagtttatcagtaggaagttatttttgaaaacttgtaaaatgtatattttgtatatcaggatcatgttttcaatgcgttcttatcaaacaaaatacaaactatcggtttacgtttaaagtgaatatttgaactctggtctgatgcg