Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:94-f6   

Cenix:94-f6RNAiCenix:94-f6
PCR_productcenix:94-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34D1.5 Source_evidenceePCR539WS150 Sequence/Annotation Release
Overlaps_Gene C34D1.5 Source_evidenceePCR539WS150 Sequence/Annotation Release
Chunk_score Abs_score454
Max_abs_score454C34D1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1327066313272300
Overlaps_transcriptC34D1.5 Source_evidenceePCR539WS150 Sequence/Annotation Release
WB_DNA_textTH:94-f61638ttcaccatcggaaacaatgagcaatgtgcaattttcccattatatcagtagtttcagtaccactataaaaacctggacaagtattcagaatttgttcctatttaaaagcttcttgttatcatatacggctcctccctcctccattatacccatcttatttcttatcaatatttcgaaataaccacagtttcttactcatttgttatcactattctttccgtttcgaccacaaaagtcagaaacgtaaagaatttttgtaattttttttgcaaaccacaatttatactgtatcttgaacttttatttcccaaatttcacttatttgaatctttactcagattgtattcctagaatcatatttcttcagaaaaccaaagaaatgtcagattactgtagtaatgatgcatcaccatttggagattatgatttaccatccgatgagccttctccaaaatatcaaaaactgaacaaaaatattttttcacctttatctccaacttttgaattgaaatttcaatccaaacttcgcgtaagcggaaattcaacaagtagtacaacatccgacgattccgatgatgaatctttgcatagatcaaatcaacttaaacatctagaaactttattcaaagaatcaattttacgtacatcattttcccgacctggtgtttcgaacacatcttgtgatgaaaaattagacttggtaaaaattgaagacaagggagataaattataatttgttttttttttaggtatccgaagatgagaaaaaacgattaagaaacactgaagcagcaagacggtgccgagaaaagatcaagagaaaaactgatgatttagaaacagttagtaatattttttagatataatttaagggtacatatgggtttatttccaccccaataatgttttccaaatgtttttttcacgcaacaaaatatttaaactttacttcaaacttttcaagaagaacgatcatcctattactgtatgttcttgcatgaaatgtcgactcagtaacagcctcataaaatgtcaattgagtatccaaaataacatttccaatcatatcatattttgaattttggtttccaggaattgacaagattgactgctcgtaacgaagtaatgaaccaacaccgtattcgtcttttgtcacaggttagtactcttatttgtgtacattatcatcatttgatttttccggagtgtttatagttttccatttttccgtcttgtgacatttgggtgatgagcacatagtgatgagcacgaatttctctatttcctgtaaattgaaacatttcgaaattcttatcactgaaatagaaatagagtatggcgattttagagtatgtgaccatcctagttaacaaacatgaaacacgaccgaatttcacacggaagtgatcatgatgtggtgggtttttatctcttgtagacagatgaagactagccatgtaacaatttaagagattcaacattaccttggacgtcacatgactgaaactgataagattactgtgggaagatgtgattggtaatgggcggaggttcttatgcaatattttttaaatttcaggtagaggaacaaatgagaatgttggaaaatataaagagccgaaacccagaacttgaagc