Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:96-g2   

Cenix:96-g2RNAiCenix:96-g2
PCR_productcenix:96-g2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
Overlaps_Gene F46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV2063218520633524
Overlaps_transcriptF46B3.16 Source_evidenceePCR633WS150 Sequence/Annotation Release
WB_DNA_textTH:96-g21340gcgatgagcacaacttgaaaacaagtttttttgaaacttgggtggagataattaggaggagtctgcaaataatggttttaaaaacagaaaagcttgtaaaggcacctggaacacaagttgtaattccatagcccgagacacatttcagtccaagagggcatcgcgcagtgaggcatggattgacggggattgaatctttaaatatagcattttgtcttttaaaaaattctaaatctaatttttaccaacctgccatacagattgccacagaagttttgcgaaaaatggctgaaacggtgcgactacaaagttaataaattgacaataaaaatggtaagacacgcatgagttacttctacaaatatcaagttctagacccactatccaagagacactagcggcatcttgagtcatccaagctgtgaagaaatccaccttaatgtggcaaattttgagactgtcgattggtggcttcaaagatgtccggcacaaattgaaatgcttgttattgatgatagctggcaaggtcaaggacctgttttgtacccgttggatttcatggacagaccacaggtatgtgctattactattaggtatttgaaaattaaatatgcggtatgaaatttagaaaaaaattgttataaagcaaatttcaggtagtgaatgctggctgcctgttcctgagtcgggccatacctgtgacagatgaacaattcatgaacctgaaagctggatcagtgagcattaatagcaaaagtattaccgatagatgcataaatcagttcatcaaggtgaatacttgaaacaaattaacatcttcaattgaaatcacatttcagaactgggttaatgggaaatgcgtcgaaagtttcacccaatacactttcaaatcacaagcgatggaacgagtgaccgcggttatcctgcaaggagttcagcaaagcattgcactttctggcccggatcagtaagccttgtgttcttatatttttctaaaaattccaattttgcagatttttttgttgctcctgtgaaaaaccatgtggtcgtggtgattattatgtgattccgagccttgtcgatcccaacgactacatcagcgtgttcttctgtgcgcactacatggtgatcgctttcaagggagccgaacaagagagtcttattcgatcggccggattctgaaactattgatccgaattgcatttaacttcgaacatattattgtgttcgccaaaaccttttaaattttctcacattttgaaaatatttcccacaccactactatttctaaattacaccctctaaattttacatcttcccttgtgtttgcttttgccaaa