Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:97-b5   

Cenix:97-b5RNAiCenix:97-b5
PCR_productcenix:97-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR09E12.4 Source_evidenceePCR558WS150 Sequence/Annotation Release
Overlaps_Gene R09E12.4 Source_evidenceePCR558WS150 Sequence/Annotation Release
Chunk_score Abs_score495
Max_abs_score495R09E12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV771770772609
Overlaps_transcriptR09E12.4 Source_evidenceePCR558WS150 Sequence/Annotation Release
WB_DNA_textTH:97-b5840tgggtcaacacggatactgaacagatattacaggggtgagtaaaatgaaatgcttgttgtactctgttgaacttctcaggaatgggtatttacgcgagaataagttaaacatatccgacgtaacatatattgggcccaactattggaaacttgatgaaaatagaaatgaagttataaattggagaacaatgttgggaatgtctattgcatcgacactgatctcgatttccttcgcaatgattgtcatttttgcaactttaagctacaaagaggtctccaagctaaccgagctgacttcccactccgaaaaattccgttcaattcaactgcaacttttaaattctttggtgttgcaatcacttgtcccggcgtttttcatacagttgccatcgttcgtcctatttctggcgcctttttttcattgtggaaggccagtgtttggcgagataattggtgtgacggttgctctatacccagtcttggactcacttccaacaattttagtgatcaaggctttccgtgaagcaatatttcgtgagtaaaagttgccagccaaataagttgagtgtattttccagattgttgcccattcactaataaaaatgctacacttcccacatccgtagcactggttactattcaataataatacattcaatttaaatgatagaaaatggactgtataacttaatcgaaacttgtttttacactttgcaagaatctgattattttaaaatttttgtagatcacaacgatatgggacattatgacaccacgagagaaatgtctgaaaatttacacacatcaaagtatatacaataaatcggtcattacggctca