Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:97-g5   

Cenix:97-g5RNAiCenix:97-g5
PCR_productcenix:97-g5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR186.6 Source_evidenceePCR520WS150 Sequence/Annotation Release
Overlaps_Gene R186.6 Source_evidenceePCR520WS150 Sequence/Annotation Release
Chunk_score Abs_score499
Max_abs_score499R186.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1296133412961853
Overlaps_transcriptR186.6 Source_evidenceePCR520WS150 Sequence/Annotation Release
WB_DNA_textTH:97-g5520tgatctgcatccttccactgcccaacagcccaatcgtatactgcatccactggaatattccgtgctccttttatatgtccatacaatgctccttgagcagttcccaagaattcatcttttgtctgtgcatccactacatcaaaattgtcaatttcagaatttagaagaacatcatcatacgttataattacagaatcattccatgaagcaagaaaatctccttgtcttggttttcttggagcatctccttgctccgttttatattgtccacttcttgcttgatgagttttccatcccaaatatccacccgaaagcagcgaaactttttgatgtccgaataatttgaaaatccaaacagtataagaactccaaatcatttgtcctctatcatatactatgacgtgacaatcattatcaattccctgagatcttgcgaatcgttgaaattgaagtggatgtactggaacgccagcatgactaagatttgaatggaaaatgaggcgggctgattcaatatgat