Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:99-d9   

Cenix:99-d9RNAiCenix:99-d9
PCR_productcenix:99-d9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY116F11B.2 Source_evidenceePCR584WS150 Sequence/Annotation Release
Overlaps_Gene Y116F11B.2 Source_evidenceePCR584WS150 Sequence/Annotation Release
Chunk_score Abs_score498
Max_abs_score498Y116F11B.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1979575619796724
Overlaps_transcriptY116F11B.2 Source_evidenceePCR584WS150 Sequence/Annotation Release
WB_DNA_textTH:99-d9969cagaaggcaccgagattcatgcttagtgtgagccagtcggagcacgcgtttagcaccccttgaactcaatctttgaaaaactggggtccatgtttcaacaattttttccgttcatagtgtagatttttcacaagggtactgaaaatatgttgccggaaaaaactgctggtatatgcaatattactttattaacatcattattaattattattaatatgtttcctataaaccagatgaatagttcaccaatttttacacgtgaacttagtgattacatcgccaccaatatcgatccgccactgccccggagtggctgcgaattcatcacaaagcgtcgatacaacctgacttcccgcattttgatcagtaccaccgagatcaaaaatcgcgtcagttccgtatgggcatgtgaacgccgcactgaaaagtatgagggtcaaattatttgagcagctagctagaaactcacatgcaagtatcaacatctctataatagttgactgtgacctcggcttcagtgtaacaccagtcggtgttgctcggattatccacgccatagcaatctgggttgtacaccattggaagacagaaagtgcaagctgaaaaatcagattatgcctgacaggatccccaagaaaacttactgagagccggaagatttttgcatttgaaagtgtcaaaatagattgggttaccaaaatatgttgcataccacgatccctggttgcctccagtttcttgacaaaatgctccactaacttcatccgttatcaccgtaccaccggactcgtacaccgcatatgtccccgttgggcatgtccattctgcgctgaagaaaatttgaataaatgcttctatgagtgaagtaaaaaacttacacgcattggtcgatgtaaaaaggatctaaagagtattgaggtgaaaccgcagcctcagtcgcacaccagtcatttgcatctgggaaacctg