Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:99-g3   

Cenix:99-g3RNAiCenix:99-g3
PCR_productcenix:99-g3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY18D10A.1 Source_evidenceePCR923WS150 Sequence/Annotation Release
Overlaps_Gene Y18D10A.1 Source_evidenceePCR923WS150 Sequence/Annotation Release
Chunk_score Abs_score923
Max_abs_score923Y18D10A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1280223412803924
Overlaps_transcriptY18D10A.1 Source_evidenceePCR923WS150 Sequence/Annotation Release
WB_DNA_textTH:99-g31691gatttttcgaccaaatcggaaaattaagcgttttttcagtgaaaacatgtaagttcaagatttttcagccaaaaaccataactttggtgtttttcaagcgaaaaaaaaaagccaaaacatgctaaaaatccaaatttgtagctcaaaaaactgtaaattttcacgattctccacttaaaaaccacggaaattccagattttcagccaaacaacccttaaatctcgcgattttcaatcaaaatgctcactttttttggtgtaaccggtagtgcggatagtctcgcagatctccgagtcaccatagctggaatgtgcttctcctgtttctgatgttcttcagtctctgaatctgatcccggatccgacattgataatccaaaatcttgtggaggatcttggagttctgaagccgctggagctggagcaggtcctggagcctgtgatcttccagcagaagcttctgctctcattctcgcagctttctctttcaccgattcgcctttcatcatctctgtctgcagttctcgtacagtttttcccttttttccatgaattgatgatgatgagccgggctccgatgctcctgcagctccctgagcacctaaaagtgccttttttctctccgcagtcgcctgagcaatcgtttcaaaatctgaagttggaaactgatttcgatggattttcgtcgagtttagaagcccaaatgagtctttttccgtcggtttatggatcccttctggccattttttcacaaatttcgtctccacgagccgtggagcacgcgattttgccttcaattcgatcatttttgcggtgaaatcggggcggcgaacggttttctctttgacacgctgtagaagttcattctcgagctgtcggatctcacgatcaacttcatcgtcggcttcatcttctggaacttcttcttcttcttcttcatcatcactgagagtttgttctccaattggtggagctggctctgtgatgacgtcatcaagatgctcaggatcttctgaagcttcagcttctgtggccgagatggaaggatctgaagtggacaatgagttcttccatggttgagaattgaaaaagagacgaacatcgtcacgtcggaagactgttaccagatccttgatgctttttgattgctttgagagatttgatgttgaagctgaaattagaggaattattgtagtttgtagtctaggggggaaggtttttctttgtggaaattcgagtttttaacggaaaaaaaacgcgaaattatgagattttttgcttggaaattgtgaaaatttccagtttttgacagaaataaacctcaattttagccaaaaaatagtgcgcgaaataccatcttttccctgatttttgaacaaaaattggaaaattttagattttttcagtaaataaaaccaattattggctgttaaaagccaaaaatgttccaattttcgccattttttgcctaatttatggcaaatttttcggtttttaaaagtaaaaagccattttttcaacaaaaatatagatttttgagtgtaaaatgctgaaatttcacgatgtttgttttaaaatcgtgtaaattccaatgttttaaatgaaaattttcaaatttacgtaattttaaaactgccatttctaacgaaaaagtgaaaaatctgcacttttttgcgtgttttaagcgaaaa