Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:99-g8   

Cenix:99-g8RNAiCenix:99-g8
PCR_productcenix:99-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37H2A.11 Source_evidenceePCR514WS150 Sequence/Annotation Release
Overlaps_Gene Y37H2A.11 Source_evidenceePCR514WS150 Sequence/Annotation Release
Chunk_score Abs_score472
Max_abs_score472Y37H2A.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1814653318147283
Overlaps_transcriptY37H2A.11 Source_evidenceePCR514WS150 Sequence/Annotation Release
WB_DNA_textTH:99-g8751ggtcttgcatgcgaatttttatcaattctgattgttttttagtaaaacaattaaaataccctgttgtaagatatactgcctaactttctagttttcagggaagtgatcaaaatcgataaggatgggtttcagaaggttctcaaaaagcatgcagccaagaaccctgctcccaaggttgagaaggtccaagccaaaagagctaataataacagaaaaaaacgagatagccagcgcacagtagaaaaggaacatataagccacggaattgtgagcaccgagattccagcagcggatccgaaagcccacgatgaatcgcctaaacagatgcctctagtaaagaaatcgaagaagagccagaaaaagaccaacaaggaaattgtggaagtagctccggaggtaagagatgaggcaccacagctggaatcccaagtaaagaaacctaagaagacccagaaaaagctcaaaaagccgagctaccgagaagttgtggaagtgagcaccgaacctcaaacaattgaggaaaagggttttcctcgtgagttaaaaatttccgttatgaccaattttccttatattccatatttcaggtatcatctggattgccagcgtcatttggatccttggagtttttatggttttggttaatggtctccttatcaaatgagtcaagggtgtgattattaccttgagcaaataaattatgaaatctatcagtttactcacatcacttccccagcaaaccctgaaataa