Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP12H1   

SP12H1RNAiKK:SP_12H1
Sequence BE228120
SP12H1
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT20F5.2 Chunk_score (4)
WB_DNA_textBE228120439ccaagagaaatcttcagttgtactcggtcagaaanggttacgaggtttcaccatcatgtgctcatcacttcgttcggcgcagtatcgccgaaggtctccgctcgcaagatcactacactgtcgatgttctgattggaggatatgatgacaaggaggacaaggctttcctaggatctgtngattacttggctaatggactcgggcaacagccgtacttgttccgaggattctgcggacgcttctgctatgccattatggatcgtgaatacaaaaaagacatgactgaggctgaaggactcgctttgatnaacaagtgcatcggagaggctaaaagacgtttcgtcgccaacattccgggatacaaagtggngatcatcgataagaagggataccgcaaatnggatgatgttcttttctaaatttctggccccggaatata