Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP12H1   

SP12H1RNAiKK:SP_12H1
Sequence (2)
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT20F5.2 Chunk_score Abs_score233
Max_abs_score233T20F5.2
Specificity_index1
Rel_score1
WB_DNA_textBE228120439ccaagagaaatcttcagttgtactcggtcagaaanggttacgaggtttcaccatcatgtgctcatcacttcgttcggcgcagtatcgccgaaggtctccgctcgcaagatcactacactgtcgatgttctgattggaggatatgatgacaaggaggacaaggctttcctaggatctgtngattacttggctaatggactcgggcaacagccgtacttgttccgaggattctgcggacgcttctgctatgccattatggatcgtgaatacaaaaaagacatgactgaggctgaaggactcgctttgatnaacaagtgcatcggagaggctaaaagacgtttcgtcgccaacattccgggatacaaagtggngatcatcgataagaagggataccgcaaatnggatgatgttcttttctaaatttctggccccggaatata