Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP15F8   

SP15F8RNAiKK:SP_15F8
Sequence (2)
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
WB_DNA_textBE228140554gatgaagatgtgaccaaagtcttgcggaaagtgattgaacgggagagctttctacttccggagaacgttttgcaaaagattgtggagaagtctgaaggaaatctgagaagagctattctgatgactgaggctttaagaatggagaacgagagtggtgtggctgaaagtgtagtaattccggttccggaatgggagatttatatccaagagactgctcgtctgatcctccagaaacagagctccgatatgcttctgaaagttcgcgaacgattgtacgaattgctctccagatgtattccaccaactgtcatttttaagaaacttctcgagcatctccttcccaaatgtccgccacaaattgcacgtgaagttgtcagtgaagcagcgaaattcgagcatcgccttgttctcggacaaaaagcaattttccatcttgaaggattcgtcgccgctttcatggacatttaccttactaatgcttctaaacccaagtgatctctgtccccgcgtattatattattctacttttgtgtaatcataaacttgaaacgaac