Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP18D5   

SP18D5RNAiKK:SP_18D5
Sequence BE228138
SP18D5
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneH37A05.1 Chunk_score (4)
WB_DNA_textBE228138368ggggatttgaagcagttttccccgtggcaatccgttctacgttggcttcggaaatcgtatcactgacgtggtttcttacgaagctgtcgccgttccagctgctagaattctgataattgatccaagcggcaaagtgaagagatcagattcatcaggattagcgttgagctacaagtcaatggccagtgatacggnggactatatgttccctccactctccgttcatgtgaaaggtgatgcacgaaaaactgaacgtctcacgtctacatggagcaagcccttggagcacagcaacttcacacattggcacatgacaccaaaggatgtacacgatgatgagctcctagaatatgaagctcagagaaaaa