Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP3F12   

SP3F12RNAiKK:SP_3F12
Sequence (2)
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF28D1.7 Chunk_score Abs_score456
Max_abs_score456F28D1.7
Specificity_index1
Rel_score1
WB_DNA_textBE228050360agggnacggagaatagggttcgactccggagaggggggaaagccgaagggactctgcacggctcgcaagctcaagactcatcgtcaagagcaaagatggaacgataagagatacaagaaggctcacattggaactcgctggaagtctaacccattcggaggagcttctcacgccaagggaatcgttcttgaaaagatcggtgtcgaagctaagcagcctaaccctgctatccgcaagtgcgttcgtgtccagctcatcaagaacggaaagaagatcaccgccttcgtcccaaatgacggttgcttgaactttgttgaaaaaaacgacgaagtgctcgtatctggtttcggacgttccggt