Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP6F12   

SP6F12RNAiKK:SP_6F12
Sequence BE228107
SP6F12
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF35B12.5 Chunk_score Abs_score1616
Max_abs_score1616F35B12.5
Specificity_index1
Rel_score1
WB_DNA_textBE228107437gcttaagcgggaatgaataattacgacgacttaccctgctctatttacttcaaaaaaccaactgtccaggagtttgtggatcaaccgagagtcttcgaagattctgaagtccctgcctttcaagaagttcttcagcttccacaagaaaggacaaaacccccagtaccatctacgcagccaattgtcgccgctgtagaagtagccaagaaaaaatcgtgtctttcggctccgaaaccaagaaaagagccaccttcgcatccagcgcttcgccaaaaaacagttgcgtttggagaaacagttaacgtttcccaaactgtcgagggaacatctcggaattcaaaaaaagtgcttgcttcaacaatgtctgcccaaaatacgacaacgactgaagaacaggcagctgaaaactggcgggacgctatgaaaacagaactgca