Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP8C12   

SP8C12RNAiKK:SP_8C12
Sequence BE228065
SP8C12
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF17C11.9 Chunk_score Abs_score1110
Max_abs_score1110F17C11.9
Specificity_index1
Rel_score1
WB_DNA_textBE228065698gggggngcgtcgcttcactagattctccgactcgttggtgacatcatgaccggaaaactgtatggaaacaaggacaacttcagaacccaaaaggttttgattgctgccaagctcgccaacaagactgtcaccctcgccggagatgctgctccagctgacaagttcccacttggagttaccccagcatttgaaggagatgctcttntnttcggagctgagtcgatcggacttcacctgactggaacctcagctaacgccgagactgtccaatggcttcaattcgcanaaggttatcttcttccagctgttctcggatacgttcttccatctgtgtctgcagccaactttgacaagaagactgttgaacaatacaagaatgaactcaacggacaactccaagtactcgatcgtgttcttgttaaaaanacctacttggttgganaacgtntttctcttgccgacgtttccgttgctcttgatcttctcccagctttccaatatgttcttgatgccaacgctagaaagtccatcgtcaacgtcacccgttggttcaaaaccgttgttaaccanccagctgttaaggaggttcttggagaagtttcccttgcctcatcggttgctcaattcaaccaagccaagttcactgagctcagcgctaaagtcgccaagtctgctccaaaggccgagaaccaaanaaa