Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: SP8H6   

SP8H6RNAiKK:SP_8H6
Sequence (2)
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_Gene H31G24.4 Chunk_score Abs_score1165
Max_abs_score1165H31G24.4
Specificity_index0.638
Rel_score1
Y43E12A.1 Chunk_score Abs_score662
Specificity_index0.362
Rel_score0.568
WB_DNA_textBE228087772aggcgttncgagctactacaagcattagaaaaatcacgaaaaatttggaaaaaaggagctccgtcaagaatcaacatgaaaacggatcctcgacgccagtcaataccgaaggtcttgccgttgggccaagaacaaaactggaggaagagttcaattgcatggctgaagacatttacaactaccttgttcatcacgagaaaaaatatgttcttgacgacagcttcataaatggaggaaatgttaattctaagatgcgccgcatccttgttgactggcttgtccaagttcatcttcgcttccacctcacccctgagacgcttcacctgacgattttcgttctggatcgaattatcgtgaagaacattgtctccaaggcggaattccagcttctcggtgttgcagctttgttcgttgcctccaaattcgaagatatttacttgccagacatcctcgaatacgagttgatcactgagaacacattcagcaagaagcagatattggctatggaacagaccatcctcaacgccttgaactttgacttgtcctgcccatcttcgcttgtcttcctccgttatatctcaaaaactctcacagagaatgacgtcaatccaatcgataaggaaacgttctattatgtgcacaatatctccaagtgtctcggagaactcncattgctcgattcggncatgtctacngttccaagggcccacgttgctagtgctttcgatgatcatactcttaatattattttccgtggatnggaattaatccc