Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:213-g10   

TH:213-g10RNAiTH:213-g10
PCR_productTH:213-g10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY25C1A.9 Source_evidenceePCR143WS150 Sequence/Annotation Release
Overlaps_Gene Y25C1A.9 Source_evidenceePCR143WS150 Sequence/Annotation Release
Chunk_score Abs_score122
Max_abs_score122Y25C1A.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII30901793090328
Overlaps_transcriptY25C1A.9 Source_evidenceePCR143WS150 Sequence/Annotation Release
WB_DNA_textTH:213-g10150tccttacatgtacgtgccgaactggaagaataacacatgtcattctattgaagctgactgcaatttgcgataaagtcttgaatgccagcatataatggttgatagtgtaatatgctttggtaattatagacggggtgaagaagtatggtg