Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:215-g5_T3   

TH:215-g5_T3SequenceGTTTCCCTTGATTCTGCCTG
Length20
In_sequenceY62E10A
PCR_productTH:215-g5