Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:215-g5_T7   

TH:215-g5_T7SequenceAGAGCCAGTCATTGCCATTT
Length20
In_sequenceY62E10A
PCR_productTH:215-g5