Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:215-h5   

TH:215-h5RNAiTH:215-h5
PCR_productTH:215-h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_GeneY62E10A.12 Source_evidenceePCR13WS150 Sequence/Annotation Release
Overlaps_transcriptY62E10A.12.1 Source_evidenceePCR13WS150 Sequence/Annotation Release
Overlaps_pseudogene Y62E10A.11 (2)
WB_DNA_textTH:215-h5149tgtgtggtgaatgtgagcaaggaccagtcggtttcgtggatccagtcactgaaatgaactatgtgagccctgaacggctcgatgtgcttcctgatgttgctgctgctgctgtggaggctggaaagtgaattgagctttccggaatgtgt