Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:221-c1   

TH:221-c1RNAiTH:221-c1
PCR_productTH:221-c1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43E2.7a Source_evidenceePCR125WS150 Sequence/Annotation Release
Overlaps_Gene F43E2.7 Source_evidenceePCR125WS150 Sequence/Annotation Release
Chunk_score Abs_score104
Max_abs_score104F43E2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII73731467373270
Overlaps_transcript F43E2.7a Source_evidenceePCR125WS150 Sequence/Annotation Release
F43E2.7b Source_evidenceePCR125WS150 Sequence/Annotation Release
WB_DNA_textTH:221-c1125acttgtgaacatccttggcagccttggctttcgtttcgtccttattctttgtgtctccaaattcaatgcggagaatagctctttgaattccgtgagtaattagatgaactccccaaatgacgaga