Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:223-b4   

TH:223-b4RNAiTH:223-b4
PCR_productTH:223-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T28D6.5a Source_evidenceePCR35WS150 Sequence/Annotation Release
T28D6.5b Source_evidenceePCR89WS150 Sequence/Annotation Release
Overlaps_Gene T28D6.5 Source_evidenceePCR89WS150 Sequence/Annotation Release
Chunk_score Abs_score89
Max_abs_score89T28D6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1134161511341739
Overlaps_transcript T28D6.5b Source_evidenceePCR89WS150 Sequence/Annotation Release
T28D6.5a Source_evidenceePCR89WS150 Sequence/Annotation Release
WB_DNA_textTH:223-b4125cctcaattttccacccaaaacttccaatttttgcagtcactaccaccaccgccaccaggaatgttccctgattctccaccagaatccggttcgggatccaataatcaaatgcatcatcaacggag