Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:248-d2   

TH:248-d2RNAiTH:248-d2
PCR_productTH:248-d2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY19D2B.1 Source_evidenceePCR166WS150 Sequence/Annotation Release
Overlaps_Gene Y19D2B.1 Source_evidenceePCR166WS150 Sequence/Annotation Release
Chunk_score Abs_score124
Max_abs_score124Y19D2B.1
Specificity_index0.53
Rel_score1
Map_statusUnique_ePCRII1092264810922858
F44F4.11 Chunk_score Abs_score110
Specificity_index0.47
Rel_score0.887
Overlaps_transcriptY19D2B.1 Source_evidenceePCR166WS150 Sequence/Annotation Release
WB_DNA_textTH:248-d2211cttctcgagagctgccaagtcttcacgagcctcagtgaactctccctcttccattccttctccgacgtacctgcaaataatcgatattttgtgtttcaaacaactcgaatcttaccagtgaacaaaggcgcgcttggcgtacatcaagtcaaacttgtagtccaggcgggaccaggcctcggcgatagccgtagtgtcggagagcatgcac