Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:248-e1   

TH:248-e1RNAiTH:248-e1
PCR_productTH:248-e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06B9.3 Source_evidenceePCR113WS150 Sequence/Annotation Release
Overlaps_Gene K06B9.3 Source_evidenceePCR113WS150 Sequence/Annotation Release
Chunk_score Abs_score71
Max_abs_score71K06B9.3
Specificity_index0.35
Rel_score1
Map_statusUnique_ePCRIV41892104189367
C36A4.4 Chunk_score Abs_score68
Specificity_index0.335
Rel_score0.958
H09I01.1 Chunk_score Abs_score64
Specificity_index0.315
Rel_score0.901
Overlaps_transcriptK06B9.3 Source_evidenceePCR113WS150 Sequence/Annotation Release
WB_DNA_textTH:248-e1158gggcagttatgacgtcacctggaacagaggaggctactcgtgagcatgtgaagaaactggcggctcatcatggattcgatttcgatgaaaaaatggccttcattccgagatgacaaactttttgggtggcaaaggttctttgggggcatagtatccaa