Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:248-e2_T3   

TH:248-e2_T3SequenceTGGAAGTTTCGCAGATGATG
Length20
In_sequenceY62E10A
PCR_productTH:248-e2