Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300E10   

TH:300E10RNAiTH:300E10
PCR_productTH:300E10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR07E5.1 Source_evidenceePCR882WS150 Sequence/Annotation Release
Overlaps_Gene R07E5.1 Source_evidenceePCR882WS150 Sequence/Annotation Release
Chunk_score Abs_score840
Max_abs_score840R07E5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII44087544410295
Overlaps_transcriptR07E5.1 Source_evidenceePCR882WS150 Sequence/Annotation Release
WB_DNA_textTH:300E101542agttggatcaaagcaaggatgggttcctcaagtgttctcatcatctcggaatgaacgtggagaacaaataaaacaaagagctgaagattttatggatgcagaagatcttggagaatatggaatagggaatcgatcgataaaacagactgcggcatttggtgaaggagctggacagaaaaggaaaatggcttgggaacgggatacgacaagtatttcaacgataactcagatgtttgaggatgttgtgaagcctgttagtaattcgataggagtacggatgctccgatcaatgggatggagagaaggacgaggcatcggattggcaaatgttaaacagaaacagaagagaggttcgagagcatatctaattgaaggaggagttatcaaaaaaagtttaaattagtctgaaattcttaaaatccataatggaaaaagggaaacatcgcaaaaaaagaagaaaaatctcgtttgtaggagtgcgatttttcgttctttggcaattttttcgtgttttctttgtggtttttcaggatggatttgaggcgattttgaattttttacagcggagtcctcaccgaaacttttcaaaaatgttttatggcggtatttaacaaatttcgtcaacttttccgtgccggaatttttttgggttgttttttctgtgtttcaaagttgttcgtctagcgttttttcgtggatttaagaacatttagagatcaaatctggtccaaatgtacctaaattcccaaaaaaaaattagataaatatcgattcccagacgctttggcaaaattcggtttgtgttttcaataaaaaaaattagttttgaagattctcgtgctaaaattcggtctttttgggccattttgagtccaagaaaccaagatttttatcgattaatcctcctttaaccaaataatcaattccttcaaaaaaaattaatttttccaggcggcgagtcgtcggaagcccaattcgaccgcgagcaagcttcaaaggtggctccagcgtacgaattttcgaatgaagatgctcttgtcaaacaactgaccccattaactggaactcatggaataggatatcaaggtcttcgtaagactactgtacttaatgagtcatacggtagaacaactttggctttgaaatccggaaagaaaaatagcaaaggaataaaaggacaagcattcggagttggagcatttgaagaagaagatgaaagtgtttattcgaattatgatctctcgcaatttgatttttcattggatgtagctggagcatcagaagagagtaatttgaaaacacagaaattggttactgcatttgaattacagccaaagaggcttaatccaagaaaattctatgctcctccaagagttccgccgaattttcgaggcgatcatcgtccgattccaatggatatctcgaaacttccacaaatgatgaagaatgatgtaaaacatatgaatgcggagcaaagagcaaagtatgatttaaattaacaataattcatattttttcgcttttttttgttttccgaaattt