Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300F7   

TH:300F7RNAiTH:300F7
PCR_productTH:300F7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC28A5.1 Source_evidenceePCR1852WS150 Sequence/Annotation Release
Overlaps_Gene C28A5.1 Source_evidenceePCR1852WS150 Sequence/Annotation Release
Chunk_score Abs_score1663
Max_abs_score1663C28A5.1
Specificity_index0.575
Rel_score1
Map_statusUnique_ePCRIII44305634432830
C28A5.2 Chunk_score Abs_score1229
Specificity_index0.425
Rel_score0.739
Overlaps_transcriptC28A5.1 Source_evidenceePCR1852WS150 Sequence/Annotation Release
WB_DNA_textTH:300F72268tcaataacacaagaataggtaaaccgagaatgcacatctggatcaagtagttcttcgttcaaatgtttcatctaaaatgtaatttaaatgaaacaaaaacttcataacaataaaaaaactcaccaattgtggtactttttccacaataatgaaaccaggaagagctgtggtagaccacaattcaaaaaagtcactctcgatttctgcattcgctggtctttctgcatttacagtgcatcgcaaataactttgtccgtcgcgaccatttacagtttgggggtcggaaaaccaattattccgatcaggtggttcctcgtttcgcattcctcctttcagaccaaaagagaatccgccgagccgacaaatgcgctgaaacacgggaaaacaatataaaataaaaaaacttctttcgatttaaaattttatgaaaacattcgaaatgattagtctactagtgactaagtaagttagtcagtcaaggaagcaaacttacatcaactttggatgaaaaatgataaactctgtacgtttctcccaactggaacgactttggcaaattattgaactttcctctgaaattctttggcattagtttggcacatttaaggttgaaaatacccgatcggaacgacgatagacatgtttctgaggttaatatcaacaccaacaccaagagcaacgaaacgtacgagtcctttgatgcaagtctcatcaaacgatggtggaaatttaatgctttcgacggcgattactgtaactgaaagtttcgttgttcgtgtcacttgcgccagcggtaaacgattccagcatttgagaatggcatttttattctgttcaacaaacatttttcgattgtttctgaaaatatgaataatcaagacacgaaaatttataacgattttgaacttacatattattatagataatatctctcagtagcacattatgcggcgtgatattcctgatctgcctgaatccatatggagcacgacgttttgggcgtccgtttaatgatccactggaactcgagccataactgtttctcggtcttactctatcaccgggagtactgtatccgaatattcgacgtcttggtggaggtgaataatcaggacgaccaatgctaattttatcaacatctgaagctagtctgtccacagttgatgcacgactagaagcttgatcatgagtggattcgtagaaagactcagttatgatctcaggagtatccatagttgtttctgaatgctgatttgtcgaatcaagccaggattcggagatgagaatattggagtcatcatttaacgcagaaaatctcgcgtcgtttctgtcgatgactgtacaagttgaagcagcactggatgattcataaactgattccgttaaaatgaaatctccggaagttgaagcactatccgcgatactttgattgtcgaacaagagctgtctttcgaatgatgactcgttcagaattgttggatattctccggtgtcgggcagattgtgatccaaactgatggaatcgttaattaagacaatgttattatcagcagctgataattgaccgtttggattggttcttgccaaagctccggaaacttcgtaagacaaattgagacttctggatgggtaattcgtcgttctcggatgctcacgaacagttgaagccagttgccgaacaacaaaaacaggaacgtttctctccatcaaaacgctgaaagaaaaataattatctcacagataattcaaataaaaattactaacaattgagcgtggaccgtgaattcttgtgtcagagacatcgctgcagtgacaccattcacatcgataatcttctgctcgaggagaggacagagaagctcgtatctggaggcgttttgaaatttaaccgtagttcgaagctgaaaagaaaaatgttgttattaaaagttgaataatattccatacccatacggagccattcgttataaaatatgctggatcttttggactttgaataacgtgttcaacgtgaatggcattcacaacgtcgtgacggtttctcggaactctggaaattcaattattaataatggatatctcagtttttaccttacctaactctgaccttgtacgaattcagtaacaattcctcattcttcacatgtacaccattagcacaaaacaatactcggaatgggattgcaatgtaatcgatgctctgtttgaagcgatcaaacgagttacttgacggatccagaactgcaaaataagtgctcgtttcattgg