Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300G6   

TH:300G6RNAiTH:300G6
PCR_productTH:300G6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16C10.13 Source_evidenceePCR219WS150 Sequence/Annotation Release
Overlaps_Gene C16C10.13 Source_evidenceePCR219WS150 Sequence/Annotation Release
Chunk_score Abs_score198
Specificity_index0.209
Rel_score0.264
Map_statusBottom50_percentile_ePCRIII41772304178692
C16C10.2 Source_evidenceePCR835WS150 Sequence/Annotation Release
Chunk_score Abs_score751
Max_abs_score751C16C10.2
Specificity_index0.791
Rel_score1
Map_statusBest_ePCRIII41772304178692
Overlaps_transcript C16C10.2.1 Source_evidenceePCR835WS150 Sequence/Annotation Release
C16C10.2.2 Source_evidenceePCR795WS150 Sequence/Annotation Release
C16C10.13 Source_evidenceePCR219WS150 Sequence/Annotation Release
WB_DNA_textTH:300G61463accctgaaaaattcagtcaattcgattccgtcttcatcatgtctcatccattcccagatgttcaaaagtgtcaacaacctgtgtcagtgatgccaaaatgcgaactgcgatcgatgctagtgcaacacaagatattgtatcagcaaaaagattgttgctgcgattccaacatgtgtgccgtgctcatcttcactcagacctcttcactgactccgcttgttttaaagacgattgatttgacgagagagacgatggtcccgtttccagtgacaacgacagagatctctttaaattcaatgtttcaataaagtcaacaatttcaataacgcataaaatgtaaactcaacagcaaaaattaacaaaaaagaagattcagaataaaatgggattaaaaaaaaagaaattaactacttctttcgttcataggtccatttgtagacggctgctcgcatagctttcgcctttttgaccttttgaggcttcaattctgatttgcttccagctgccaattgtttcttcaattccagcttgtccacgaccacttgaagctccttggcacgttccacgcgtttgatgagctcgttgtatcgagtacgacgtacacgatcggctttctggaataatttttattaagatttttcatttgttttagatatttaaggggtacttactctgacttgttcttttcatttgttttagatctttaaggggtacttactctgacttgttctttcgtaccagctccaataatagttttattttgaaaatcttcatttttcaatcgattgaattgtcgagagagcatcgaagtggttgtgtcaaagtagacgcgtggatcgaaacttttggctgaaaaattcttatatttttgagattttctttttaaaaaatgttctcaccttccgaatctgtgtccacaaaaacggtatgagtatttcctttgccgttcaacgaagaatccgcaaagtgaagttctcctttcatttcgtcgattttcttcttttcctcattcagcttgaacttgacatattccaaatctttcaagcttcccaactttttctgaatttgcgtttcagtctcttctgcttcagttttcttatcgaaatgacgaccgtcagcctggaaaattgtttaattaagacaaattaatttaaatatccagtaaatacccaagtttcactgttaaccatatgatgatggtattcgtcctgattcttatccattgccgatttcttcaactttttgatagtatcccttttcttctgataatcctctgctctcagcttgtaatccttctttttctcgagttctccatactttcggcgggcttctggctgggatctttcacggtgctggcgttggccggacagctttttgctgatactcacaagcgaggacatggctggctgaaaataattttagctcaggagaacacaatacgaaaacaaagaaatgaaaaatgg