Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300b9   

TH:300b9RNAiTH:300b9
PCR_productTH:300b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0393.8 Source_evidenceePCR137WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcript B0393.8 Source_evidenceePCR137WS150 Sequence/Annotation Release
B0393.1.1 Source_evidenceePCR888WS150 Sequence/Annotation Release
B0393.1.2 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textTH:300b92058tcaaaactatgcgaccaaggctgagagagcgacattttcggaaggcacgagtgtagaaaagtcttccgcagagattgagcatttgactttctgaaattatattcataatccagctattcactttttgaacttacgcgatgaccaatatcttgttctgatcgttattgacgattttgtacatattttatgtgacggaattcatcgcgctgacgacatcaacaaatcatttccagactggagcaatatcgagctctgaaaaggaaaatttaaattttttttctttaagccaccgaaaatagctataaaactaaaaatgacgtttgactgcgcagagaattgaaaagtacgatattgaattcaataaatatacatgaaaaagagtaaaaactgcgaaaagatcacgaaaattgaacaagaacgacagaaaaaccaagtttattgcgaaaaactaacattagatatatcctcgtaaatcgacacagcgggtctcgccgcgatttgccgccaacaacgtcaccaactacggtatgtgtggatgtcgagaaatgcggagaaattgcgaatttcacgtcatttctccgcacacttgcattgcaaaaaaattgtcgagaaatgacgagaaattcacttgcatcatcccattactgtaatttttgaaagcttacataagaggaaaatgggattacgattttaatctcgtctattggcacaagtaatattcattaaattctttaaaacgttcgccgtccctgtacatggtcttaataactgttgacttttcttatatataaatttgttcaataacctcataacatagttaacaaggtttatttcaaagaaccaacattgtaacaaattgattaccagttagactgggttggagcgttggcccactcttcggtggtcttggtctcggcagtccaggtagcggtctcagcggcccaatcgtcaacctttcctccttgggtggtgaagtcgatgtcagttggttgttggtattcttgagcctcagcaacatcagcgtgagctccagtctcctccttctcggtctcagttgggtcacggtagaagtaaagatctggcatgatttcctttccttcgaggacgaatccggtttgacgggagatctttccacggagaatgaggatctcgcgagcgagcatccaccacataagtccgattgagcgttctccctacaattcaaatacatatttacattttttataaattaaatatataccttgttgttgcatggaactccgatgtcgatcaacttgagtggagactcggtgttgacgaaggagatgactggaactccgacgtaggaagcctcagtgacagcctaaattttaaataattagaaaaaacaactatttagaaaagtcttacctgatgatcgatacgtgggtcagagatgacgagaagtcttggctccttgaaggtcttttggatctggttggtaagacatcctggagagaaacgtccgaagatggcggtagctccggtatgagcagcgaacttgagaagagcacgctgggcgtatggtctagccgaaacaacgacgacatcagctgggttctcaacagcggcgatagcgcgggcagcgagaagaagcttctcccaggtcttcttgacgttgatgatatttggtcctgtaatgataattgttataattttattaaataattcacaagaaaaatgaattgaattttttttaaactaaccgtcaaaacgtctcttgtagacgtattgctgcatttggaagttaagattggtggatcccaaatgggcctgggtagcaagaagcttcataacatcctcctcagtgagggcggaatgagcggcaccgcctgacatattaccttaaaattcaaaaattaatttcagatcagtcataaccaagaaaacaaaataaacgttaggacagaaaattcaaattaattaaaaattatgctgaataagaaaattacatgcaaagccttattttcctcatagaaacagttgaataacatattttttaattgaaaacatagcaaaattcgtggtaaaatttgtcaa