Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300c6   

TH:300c6RNAiTH:300c6
PCR_productTH:300c6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C36E8.5 Source_evidenceePCR1511WS150 Sequence/Annotation Release
Chunk_score Abs_score1385
Max_abs_score1385C36E8.5
Specificity_index0.951
Rel_score1
Map_statusUnique_ePCRIII40158934017836
C54C6.2 Chunk_score Abs_score72
Specificity_index0.049
Rel_score0.052
Overlaps_transcript C36E8.5.1 Source_evidenceePCR1511WS150 Sequence/Annotation Release
C36E8.5.3 Source_evidenceePCR1358WS150 Sequence/Annotation Release
C36E8.5.2 Source_evidenceePCR1437WS150 Sequence/Annotation Release
WB_DNA_textTH:300c61944cacttcactcagatgcaaacttttcagtgactataaaaagtcataaaataataacattaaaaaagcaaataaattagcgagagaattttttgacaaaaagaaagaagagtgatagagaagaagggaatgcttgaaaggatcttgcatttattgctccgattcgtaagtctctccagcttctccctcagcgtatccgtcgacgtcgtcttcggcagttgcttcttggtattgttggtattctgagatgagatcgttcatgttgctctcggcttcggtgaactccatctcgtccattccttctccagtgtaccaatggaggaaagccttgcggcggaacatagctgaaaaaataacgtttttaaaactgatactggatgatagtttcaaatttcttaccagtgaactgctctgagatacgcttgaaaagctcttggatagcggtcgagtttccaacgaaggtggcagccatcttgagtcctcttggtgggatgtcacaaacggcggtcttgacgttgttcgggatccattcgacgaagtaggacgagttcttgttctgaacgttgagcatttgctcgtcaacctctctcatcgacatgcgtccacggaacatagcggccacggtcaggtaacgtccgtgtcttgggtcacaggcagccatcatgttcttggcatcgaacatttgttgggtgagctcggcgacggtaagggcacggtaagcctgggttcccttggcggaaagtggtgcgaatcctggcatgaagaagtgaagacgtgggaatggaaccatgttgacggcaagcttgcggagatcggcattgagctgtcctgggaatcggagacaggtggtaactccggacatggtgagggatactgaaaattgtaattattaggtttcaatttgggtaacttgtgcataacttaaacttgaacaagaaataataacttaccaagatggttcaaatcaccgtaggttgggttggtgagtttgagggtacggtagcagatgtcgtagagggcctcgttgtcaatgcagtaggtctcatcggtgttctcaacaagctggtggacggagagggtggcattgtatggttctacaactgtgtcggacacctttggcgatggtacaaccgagaatgagctcatgattctgtctgggtactcttcgcggattttggagatgagaagtgttcccattccagatccggttcctcctccgagagagtgagtgagttggaatccttgaagacaatcgcatccttcggcttccttgcggatcacgtcaagcacattgtcgacaagctcagctccttctgtgtagtgacccttggcccagttgtttccggctccgctttgtccgaacacaaagttgtcaggacggaacagctggccgaatggtccagagcggacagaatccatggttcctggttcgagatcgaccaacacggcgcgtggcacatactttccgtctgaaaaaatttaattaattaatcattccaactaaacgatttcgaaatctccagaaaattttaaaaactcactgttggcttcgttgtagtagacgtcaatgcgctcaagctggagatccgtctctcccttgaaggttccgtctggctggattccgtgctcgtcggagatgacctcccagaatttggatccgatttggtttccgcattgtccggcttgcacgtggacgatctctctcatttttgctgaaaaggtcgtaatgaattgaaaaactatatttagatagagaagatgaaggaaaataacaaaagaaagagaacacgtcatggtcgatattgaaaagcaatgattcacggcaaaaatttaaaattaaaggagtaagtttttttaatacattgaaatttgagagatgtttaattggtgatttgattctagtttattgtgctctgaaattaaatgattcacggcgaaaataagaaa