Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301C1   

TH:301C1RNAiTH:301C1
PCR_productTH:301C1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0285.9 Source_evidenceePCR967WS150 Sequence/Annotation Release
Overlaps_Gene B0285.9 Source_evidenceePCR967WS150 Sequence/Annotation Release
Chunk_score Abs_score820
Max_abs_score820B0285.9
Specificity_index0.754
Rel_score1
Map_statusUnique_ePCRIII43681794370289
B0284.1 Chunk_score Abs_score267
Specificity_index0.246
Rel_score0.326
Overlaps_transcriptB0285.9 Source_evidenceePCR967WS150 Sequence/Annotation Release
WB_DNA_textTH:301C12111tttcagtggtggacaatcgaatcacatgttccacgtgacgtcatctacatcagccactccatatcttttaagaatccatcgtcagcctccgagccaagttttcacggataccgtcaatttggcgattttttcgggtgtgtggagtttactaatattaaaactgcacgtaaaatgtgatgtattgaaaaattcacacagttccctttttttcagagcgaggacttggtccaaaactttatgggtttttcgaaggaggaagaatggaagagtttctcccgagtaaaacttttgatgtgaatgatgttttggttccagagttagttttaaacttattttcataaactatttgatgtatttttcagaaattctcgaaaaatcggtgcaatcttcccactctatcattcaatcaatgttccagtttcaaaaagtcgccggtgtgttcacttgatgagagaatggctcaatggatacgagtgagcaaattttgcagtttaagactaatttatttgaatttttccagaagtcttggaggtggtgactatgagattttgccaactacagtcaactattcggatcatcctaaatcagtttccatcaaagatctgaatcatgaaatcgacaatttcgaaaaatggtcgactgaaatttttgagcacactttggtcttcagtcacaatgatctagcggtaaaatatttatttttttaactaacaaaaatgtatttttcagtctaccaacattctcgagctcaactccacaaaagagctcgtattaattgattgggaatttggaacttataactggagaggatttgatttggcaatgcatttatccgagacagcgattgattatcgtgtaccatttccacctggaatcaagatgaatggagatttaattgataatccaccaaatattcaaattttctgtgaagcttatgttgaagctgacaaaaaggtaagaattctgatagggaacgatatgattttatatatttcgcgcaagatatgatgaattcggcaagggaacccaaccgtcgtaatgctatatattttacgcgcaaacttattcactacagtaatcttaatttcgcaaaataaatgttttcttctcaaaactaacatactaaatggcttaacaaaaaaaccaagcgaaaaattggacgtgacgaacgaccgtcatgttctctgtcgtctctattccgtccattactctctcgatatacccctctgttatattttcccgctagtcgggaaaaaccaccgagcgtcgtggcgggcgcttgtgagtcagcttcttgacggtagatgagtgtggatggagtgagaggaggagtcctgtgtatgtcgttgtcaacgtcgaccgagcgtccgtgccaagcgctgcgtcaccaggggatgactgtcggaagatggtcagtcccgggtgcataaggagtggtggatggttcaggaccgaaaggtagcagacaaaagccaccgcgcggtgcagtggccggacagcgcttgtgagttgacacgtatacacagccttctcaataccttcagaccacttgtcactttttgcaattttgcaattttatgcaatcggtatttaaaccatgttttacaaaatttcaagaatatttaagacataagaactactaatgttttttttcagctcaaaaaccgttcaccatcggatccaactgctgaagtgaaagctctaattcaagaatgtcaattcttctggcctcttacaaatctcttctgggcactctcagccatgaagcactcacttcttaaattcgaaaatggagttgatttggacgtgcaagcacgtgatcgattggcagtttacttccacttgaaaccaagatctcagaagatttacgaggaattgagcaagaaatgatttgcaactaacatgtatacttatttttgattgatgatttctgtgaatgaattatttccttaaagtttttgctcacctaaaaaaaataccagaaacataccagaaagaggaaattttcaaatgaaatgtccttgtctcctacgcggcatgctagcttttttccttatctctgaaacaaaaacttttccgaggattaagccgaaggtcgaatggtatgcttg