Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301E3   

TH:301E3RNAiTH:301E3
PCR_productTH:301E3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04A8.12 Source_evidenceePCR647WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.12 Source_evidenceePCR647WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIII47055104706635
WBGene00007045 Chunk_score Abs_score572
Max_abs_score572WBGene00007045
Specificity_index1
Rel_score1
Overlaps_transcriptT04A8.12 Source_evidenceePCR647WS150 Sequence/Annotation Release
WB_DNA_textTH:301E31126aatcccattcaagtgagttttatgcacacttttatcttcaatttaatgtttttcttccaggtatttcgttatctgtatcggaggtctaccatcttcagcacttttaatatgtgttatattatctcttctactgcactttgatcaggcaacatctacacattgtgaagttgccaactggttaccatccatatcagctgcagtctcaacgtatacacctgaaaagtatatttggagaattctaatcggattgcatattggaccccgattggtagttgcaattgcattcagaaactttttattgggatctcctctacgacctcttactggacataaaaggcttcggtttttgtgcaatttggcttgctttctcaatcttctagagaatttcttccttctggcattaacatcgatttcatcaagtgaagatcactgtaagaactaaaatgtatgaaatagttaactatttttaaattcagctcttcatgctaaatgcttcggtggatttgctatttgttcgattatatacatgcttttgagcacatggcttttcaatgaaactggaaggagaactgcaacaaatttggtaagtttgctcacataatcttgaaaattaaagagattagtaaataaaaaagtaaatattatctagacacgagtagtttcgccataaatacagtactcgacacgcctttttttctgtaaaatacaaacaaaagatggatcgatgaaaattctacagcaaaaaggtttgaagctacagtaatcttcataggcgcacatcagtttgtattaaagacaaaaatgtcgtgtccggtcaccgtagttttggcaaaatctggcgtcttgaataacaatttacgaaaaaaacctttatcccccaagtctaactattttcataaatttttatttattctccaaaacttgttatctgtgagaaattaatttagaaaattaatactgaaattgcagggtcaacgttcgcacgaatataaaatcctgggagctgctattttcgttctatgctttttccttggagcatatctttattggaggcataacacgtactgcgagccaggaatttacacgctcttcgcacttgtcgagtactctgccgttttatcaaaca