Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301F7   

TH:301F7RNAiTH:301F7
PCR_productTH:301F7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF48E8.6 Source_evidenceePCR1722WS150 Sequence/Annotation Release
Overlaps_Gene F48E8.6 Source_evidenceePCR1722WS150 Sequence/Annotation Release
Chunk_score Abs_score1659
Max_abs_score1659F48E8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII54432755445434
Overlaps_transcriptF48E8.6 Source_evidenceePCR1722WS150 Sequence/Annotation Release
WB_DNA_textTH:301F72160tcaaaaccactccaacaaaagcaaaaccatatgtgaagccgcaaaatgcaaataatttgcaaaacaacttcaatccgcggaaaatcttcaccgaatacatatcaaaggaggaaacagatgccggaatcgaagacggttcaatgttcaaaggtgtcttgcggataaatccaaaaaactatcaagaatgttttttggatcatccaaaaggcacaaatcatccagatgttcttgttttgggccaagatcggaatcgtgcgatgcaaggagatgtggtggctgtaaagatcaagccaaaagaggattggcttgtacggtttaatcatttgaaaaaaacaactagaactgatttcatccaaataatacctatttttccacgaatcttttagagctttgtggatattcttcctgtagattacataaatttatttttaattctaggaatttaaaaatgagaaaaaagaaaacatctaaaatccattaaagcctgctaatttcgaatagttatatgcaaattatgttcacaaaatctgaattcttcgaggaaaaaactatttttccaggtaaactatgtggaatatgtgaaatggtgggcggagcacaagaaaggagatcgaaatagcggcaaaacggacaacaatagcccaaataaaacagaaaaacgatgtctgcgcaacgaaattcaagacaatggagttacaagtgacgaagttcccgattcttgtctcatcaccatcggagccattgttcatatccttgagaagaaacatttccgtgtagccgccggcaagctccagctaatgccaaacagcgcgaatcccaacgtgttgttcgttgctacagattctcgtgtccctcgaattctcattccaaaatccgatgtggataaggagttcttctcacgcccaaaggactttgagagattcctttacacagctaagatcactgattggcgcgctgaatctgtttatgccgatggaagactcgtgaagcttcttggcatgtccggagaaatcgatacagaaactgaaagaatcgtctacgagcaccaaatcgatcacagagagttcagcgacgaatgcctcgaatcacttccaatcactacagccgaaaactggaaggtccctgatgccgagttcgagtaccgaagagatttccgaagtgacatcgtttttacaatcgatccaaaaaccgctagagatctcgacgatgctcttcacgcgaaacacatcgatgattgtgacggaaaaggaactccaggccttgagattggagttcatattgctgatgttacattcttcctgaaagaaggtacagagcttgacaaatgggcatccgaacgtggaaatagtacttatctatcacaaactgtaattccaatgcttccaagaatcctctgtgagcagctgtgctctttgaaccctggagtcgatcgcctctccttctcaactgtattcaaaatgagctacgaagccgagctgtatgatgtttggtttggaagatctgttatcagatcccgtgttaaacttgcctacgaacatgcacaggatttcatcgagaacccggagaaggacttcacatgcgacgagcttcccgatatttcagatggaaatacgccttttgagatcaaggaaaagactctgatgttgcacagaatcgcgcaagttcttcgacaaaagcgtgaagatagtggagcattgcggatcgagcttcccagattgaaatttgcattggatgaggataagaagccacaaggagtttctatatacgaggttaataaacagttttttgttaaagaaaatgtgtttttatattaatttttgttttcaaacagcaattttttggtcacattttttcggttctagcaacaaaaaagtaatccataaatttagattttcaaaaatcggaaatttaaaaagaattgccaattttataaaatacaaatgttaaaatttcagatcaaagattcgaataaactcgtagaagagttcatgctgctcgccaatatggaagtggctaaaaagatcgctgaaaatttcccagaacacgcccttcttcgtaatcacccgccaccaaaagagaaaatgataaaggacgtggctgagcaatgtgcaagaattggatttccattggacggaagaacgtctggattactttccacgt