Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301G5   

TH:301G5RNAiTH:301G5
PCR_productTH:301G5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F54D8.3 Source_evidenceePCR1238WS150 Sequence/Annotation Release
Chunk_score Abs_score1154
Max_abs_score1154F54D8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII50792805080722
Overlaps_transcript (5)
WB_DNA_textTH:301G51443gactattccaatcgagggtgactacttcacttacactcgtcacgaaccggtgggagtctgcggacagattattccatggaacttcccacttcttatgcaagcttggaaacttggaccagcgttggctatgggaaacacagtcgttatgaaggtcgccgaacagactccactttcagcccttcacgtggctgctctcacaaaagaagctggattcccagatggagtggttaatatcattccaggtcagttttgtaaaaattgtgagtttctcaaataaataaattccaggatacggacatactgccggacaagctatttcgtcgcacatggatgttgacaaagtcgcttttactggatcaactgaagttggaagacttgttatgaaggctgctgcagaatcgaatgtcaagaaggtcactttggaactcggaggaaaatcaccaaacatcattttcgctgacgctgatctcaatgattccgttcatcaagccaaccacggactcttcttcaatcaaggacagtgctgttgtgccggatccagaacatttgtcgaaggaaagatctatgatgatttcgtagctcgttccaaggaattggccgagaaggctgttatcggagatccatttgatttgaaaactactcaaggaccacaagttgacggaaagcaggttgagactattttaaaatatatcgctgctggaaagaaggatggagctcaattggtgactggaggagccaaacacggagatcaaggacactttgtgaagccaactatcttcgctaatgttaaggatcagatgactattgctcaagaagaaatctttggacctgttatgactatcattagattcgacacaatggaagaattagttgaaaaggctaataacactatttatggattggctgctggagttatgactaaggatattgataaggcacttcatattgccaacgcaaccagagctggatctgtctgggttaattgttacgatgtgttcgatgctgctgctccattcggaggattcaagcagtccggtaagctaatttattattaaaatttctccatgccaaagttaaaaaatactttttcttttaggaatcggtcgcgaactcggagaatatggtcttgaggcatacactgaagtaaagactgtcaccatcaaggttccacagaagaactcataaatttcttgaattttcgctttccctgtaatttttgttccttttgcttttttttttgaaaaatgtttattgctcttaatatacgtgttgtatttatctatttttcacatatattgaaaaagaattctgaaagaaatagacacctacaggacgactcataaaagtctcgacttctttgtgaattgattgattcaggacaaacgaattattactctgtacattagaggatcagtcgtaaaatcttcaaaaggcaaaaatttt